                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTGGTTACCGTCACTATGGCCGGCAACGGCGAGGTCTCCGCAGTGACCGTTGACCC
AAAGGTCGTTGACCCTGAAGATGTCGAAACCCTACAGGACCTTCTGCTCGGTGCATTC
AAGGATGCCCATAACAAGGTCGCAAACGTTGCTGAAGAGAAGATGGGCCCACTATCCC
AGGGCATGGGTGGCCTCTTCTAAttagttgctaaacgcagggccgggttctcgatgaacccggcttttgtcatgtatgcgata
ctgttccttgtccaatttttagttcagataggtagtgtaagacGTG

    NCgl0241 Gene: NCgl0241     GI: 19551495     BI number: NCgl0241     GOG: COG0353     Description: recombinational DNA repair protein Rec             a           a  a           t  c            cg            gc            ta           t  |   G       g  | G  C      a  | G  A      t  | AT       t  | CG       A  | CG       A  | CG       T  | T  T      C  | A  |      T  | T  |      T  | C  |      C  | A  |       Tg C  |       Cg CG        Cg         g CG        Gc       c  a GC        Gc       t  t GC        Tg        cg G  |      |  g       ta T  |      |  g       ta AT       |  t       gc GC       |  t       gc AT        Gc        gc AT        Gt        cg GC        Gc        cg AT        Tg        gc                         ttttgtcatgtatgcgatactgttccttgtccaatttttagttcagataggtagtgtaagacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0353 Recombinational DNA repair protein (RecF pathway) ... can be seen here     ..................................................................................................................