                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:177 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=12 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCGTGCATTGCTTCGAAAGAAGCCGCACATTACTAACTGGGCTGAATATTTGGCTC
AGGGGGGCGAGATCGCCGGGGTTTAAttaatttcaagggctggccattaacgtggtcggcttttttgattcagggcgcacc
ccaggcgcaccccaggcgcaccccagcgcaccacaggcgcaccccagcgcaccacaggcgcaccagcccagcacaagagccaacgcaagtgtcaggcacg
ccagcaaaggggctagcaagaagcacgcccccgaagccttagaaatgcgttccccggtaggATG

    NCgl0276 --- NCgl0277 Gene: NCgl0276     GI: 19551531     BI number: NCgl0276     GOG: NOG08630     Description: hypothetical protein Gene: NCgl0277     GI: 19551532     BI number: NCgl0277     GOG: COG0251     Description: putative translation initiation inhibito             A           A  t           T  t            Ta            Ta            Gt            Gt            Gt            Gc           C  a       aa           C  a      t  c           G  |       tg            Cg        at            Tg        cg           A  g       cg GA        Gc        gt A  T       At        gc GC       G  g       tg CG        Cg        cg GC        Gc        gc GC        Gc        gt                         tttttgattcagggcgcaccccaggcgcaccccaggcgcaccccagcgcaccacaggcgcaccccagcgcaccacaggcgcaccagcccagcacaagagccaacgcaagtgtcaggcacgccagcaaaggggctagcaagaagcacgcccccgaagccttagaaatgcgttccccggtaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0251 Putative translation initiation inhibitor, yjgF family ... can be seen here     ..................................................................................................................