                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:206 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=73 nt.     Delta G= -8.67 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTCCGACGAGCAAGAACAACTAAGGGAACTGCTGCTCAAAATCGCCTTTTAAgtctctta
accacgccggccatgttcacatggccggttttttcatgccaattagagatcggcacaattgtgaagatcgggggcaaacttattgcaaggatccacaaag
gtgcagctaagagcgattatcaccacccccgaaaccctgtggagtgatgaattttcctatagaacgttttttaaacgattgactttttaaacgtttacgc
ttttaatgacttcaaacgtgatctaaagcacaaaggagaATG

    NCgl0279 --- NCgl0278 Gene: NCgl0279     GI: 19551534     BI number: NCgl0279     GOG: COG0318     Description: acyl-CoA synthetase Gene: NCgl0278     GI: 23308785     BI number: NCgl0278     GOG: COG0477     Description: permease of the major facilitator superfamil            AA           A  A           C  T           T  C            CG            GC           |  C           |  T           |  T           T  T           C  T           G  A            TA            Cg           A  |            At            Gc            Gt            Gc            At GA        At G  A       Ta GC       C  a AT       A  c A  G      A  c T  |      C  a C  |      A  c A  |      A  g       tc A  |      G  c      t  a C  |      A  c       gc A  |      A  g       ta A  |       Cg        at GC        Gc        cg AT       |  c       cg A  |      A  a       gc CG        Gt        gc GC        Cg        cg AT        At        cg GC        Gt        gt                         tttttcatgccaattagagatcggcacaattgtgaagatcgggggcaaacttattgcaaggatccacaaaggtgcagctaagagcgattatcaccacccccgaaaccctgtggagtgatgaattttcctatagaacgttttttaaacgattgactttttaaacgtttacgcttttaatgacttcaaacgtgatctaaagcacaaaggagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................