                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:162 nt.     Distance to run of Ts=2 nt.   Size=16 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-10.07 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGATCGTCACGCGGGCACCGGAATTACAGTAAATGCGATTAGCCCGGGATTCGTGGTA
GCTGAGCCAGACGCTGAGGTAAACCGCGCAAATGGTGACACCACGGTGGAGGAGGTCG
CGGAGGCGATCGCGTTTTTGTTGTCGCCGCGCACCGCATCAATTTCTGGAGAGATTAT
TTCGGTGGGACATAAGGCGAAGGGCATCATCCTTCCTTAGctcgcgtgagcttcccaagcgtaagcaccc
ccgtgtgagggcataacggccgttctgttaaagattggtctggccatttcctccatATG

    NCgl0316 --- NCgl0317 Gene: NCgl0316     GI: 19551572     BI number: NCgl0316     GOG: COG0477     Description: permease of the major facilitator superfamily Gene: NCgl0317     GI: 19551573     BI number: NCgl0317     GOG: COG0451     Description: nucleoside-diphosphate-sugar epimeras AA T  A GC GC A  G G  C T  | CG GC        AC C  A      C  G A  A       CG G  A       AT AT        CG CG       A  G CG       G  A GT       T  G A  G      G  G G  A      G  A T  C      T  G C  |      A  G G  |      A  T       GA A  |      A  |      G  G TA       C  |       CG GC        GC        GC GC        CG        CG TA        GC        TA GC        CG        GT CG        CG        GC                         GCGTTTTTGTTGTCGCCGCGCACCGCATCAATTTCTGGAGAGATTATTTCGGTGGGACATAAGGCGAAGGGCATCATCCTTCCTTAGctcgcgtgagcttcccaagcgtaagcacccccgtgtgagggcataacggccgttctgttaaagattggtctggccatttcctccatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [MG] COG0451 Nucleoside-diphosphate-sugar epimerases ... can be seen here     ..................................................................................................................