Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:178 nt.    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:121 nt. Size=65 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:    Distance from promoter:104 nt.    Size=39 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCGA-TACAAG. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCGACTGGATATAAGACCTATTACAAGTTGTGTATGAGTATCCTGAAATTGCTCGC
TTAAcaccccataaagagggtgaagatttaagttcaggtgcgatctgggtgaacagtacataaatatcatctttcgctaatggaaagccccagctca
ccgaattctccattcgttttaattgcttcgttaattaaaacgccatataaaaaccggcgcattgccggtatttttccaggagaatttaATG

    NCgl0322


Gene: NCgl0322     GI: 19551578     BI number: NCgl0322     GOG: COG0737     Description: 5'-nucleotidase/2',3'-cyclic phosphodiesterase or related esteras


           tc
          t  g
          c  t
           gt
           ta
           ta
           at
           at
           ta
           ta
 cc        ta
c  a       ta
 cg        gc
 gc        cg
 at       |  c
|  c      t  c
|  a      t  a
|  c      a  t
|  c      c  a
|  g      c  t
|  a      t  a
|  a      c  a
|  t      t  a
|  t      t  a
a  c      a  a
 at       a  c        a
 gc        gc       c  t
 gc        cg       g  t
 ta        cg        cg
 at       a  c       gc
 at       c  |       gc
t  c      t  |       cg
 cg        cg        cg
 gt        gc        at
                        atttttccaggagaatttaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG0737 5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases ... can be seen here

    ..................................................................................................................