                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCGCCTGGACCGTGGCGATGTCTGGTTAGATACCGGCACAATCGATTCCATGTCCG
AGGCGTCTTCCTATGTTGAGGTCCTGCAAAAACGTACCGGCAACATCATCGGATCCCC
CGAAGTCGCTGCGTACCGCGAAGGTTTCATCACAGCTGAAGAACTCACAGTGCTTGGT
GAGGAACTGAAGAAATCAGGCTACGGAAACTACCTGCTGAGAGCTTTGTAAtttacggtgtg
gttgtggaggggtgcgtcgagaagcgctcgtaggcgcttttgatttttcggtaggctaactgggGTG

    NCgl0324 Gene: NCgl0324     GI: 19551580     BI number: NCgl0324     GOG: COG1064     Description: Zn-dependent alcohol dehydrogenas             t           g  g           t  g            gt            gt            cg AC        at A  T       tg A  A       tg GC        ta         g GC       |  g      a  c C  T      |  g      a  g A  |      |  g       gc T  |      A  g       at CG        At        gc GC        Tg        cg G  |       Gc       |  t AT       |  g      t  a CG       |  t      g  g TA       |  c       cg A  G      |  g       gc A  A      |  a       tg A  G       Tg        gc GC        Ta        gt AT        Ta        gt AT        Cg        gt GT        Gc        at                         gatttttcggtaggctaactgggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1064 Zn-dependent alcohol dehydrogenases ... can be seen here     ..................................................................................................................