Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions

TCCGATCCTGCCATGGGTCGCCATCATCATGATCGGCCTGTACTGGTTTGATGTTCGC
CCGCAAATCAAGAGCATCCTTGAAGGTGCCGGCGGCTGGTAAaagctccctgaactgcgaaaattcccc
tacatcccgtaggggaattttttcggcccatgtgcggttgtgtcctaagtcattgatgtcacctaacgcccctaagttcactcggtgcaatattgcactg
agtgcaagtttacactaggtttacttcagtggatattgaagagcagccctcgttaagagaaatcaagcgccaaATG

    NCgl0368 --- NCgl0369 --- NCgl0370


Gene: NCgl0368     GI: 19551625     BI number: NCgl0368     GOG: COG1309     Description: transcriptional regulator
Gene: NCgl0369     GI: 19551626     BI number: NCgl0369     GOG: COG0477     Description: permease of the major facilitator superfamily
Gene: NCgl0370     GI: 19551627     BI number: NCgl0370     GOG: COG0477     Description: permease of the major facilitator superfamil


           c
         t  c
         a  c
          cg
          at
          ta
          cg
          cg
          cg
          cg
          ta
          ta
          at
            tttttcggcccatgtgcggttgtgtcctaagtcattgatgtcacctaacgcccctaagttcactcggtgcaatattgcactgagtgcaagtttacactaggtttacttcagtggatattgaagagcagccctcgttaagagaaatcaagcgccaaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1309 Transcriptional regulator ... can be seen here
[GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here
[GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here

    ..................................................................................................................