                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGTGATGGTCGAGTGATTGCCTCCGGTTCTGTTGATCAGGTGTATTCCACGGAAACG
CTGTCCCGTGTTTACGGTTGGCCTATCAGGGTCGATCATAGTGGAAAATATGTTCGAG
TGGAGCCGGACCGTTCTGAGGCGAATTTACCCTCCGTACTACAGGTGAAAAATACGGT
TTCACCAGCTTAGatacatgactaactaaggttaccctaccctctttggggtagggctcttccatttttgccaggttaggttaagctaatc
tagtttttattgcgttatcgaacaggagaacaaaaATG

    NCgl0381 --- NCgl0382 Gene: NCgl0381     GI: 19551638     BI number: NCgl0381     GOG: NOG44360     Description: hypothetical membrane protein Gene: NCgl0382     GI: 19551639     BI number: NCgl0382     GOG: -------     Description: hypothetical membrane protei   A        ca T  C      a  t A  G      t  g A  G      a  a AT        Gc        tt AT        At       c  t AT        Ta        tg GC        Ta        cg TA       C  |       cg GC        Gc        cg GC        At        at |  A      |  a       ta |  G      |  a       cg A  C       Cg        cg C  T       Cg        cg AT        At       |  c TA       C  t      |  t CG       T  |      a  c |  a      T  |      t  t At        Ta       t  t Ta        Gc        gc Gc        Gc        gc                         atttttgccaggttaggttaagctaatctagtttttattgcgttatcgaacaggagaacaaaaATG     ..................................................................................................................