                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-14.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

catgactcaattatcgtgtatataccacacggtaaacacctgttgagagggtggtcggtttttacgccaccaatgtttgaactggccgttttctttgaaa
atcgcgctcggtttggatgccctcgtaaaataaggtgcaaatattgtgcgccgaccagttatgtcctcatccgacggcggtcagtgtgcttcattaaatt
gtcgtggacaatcccggatcgaaaatttgattcggcttttttcatggctgttgatggagtacgttggtcgttttcgagacaagtactagaaaagatattg
ATG

    NCgl0414 --- NCgl0415 Gene: NCgl0414     GI: 19551674     BI number: NCgl0414     GOG: COG0007,COG1587     Description: uroporphyrinogen-III synthase/methylase Gene: NCgl0415     GI: 19551675     BI number: NCgl0415     GOG: -------     Description: hypothetical protei   a         t c  t      a  t t  c      a  g c  c      a  t cg       t  c ta        tg gc        at tg        cg a  |       tg t  |       ta tg       c  | gc        gc a  |       ta cg       |  a       aa cg       |  t      a  t at       g  c       at gc       t  c       gt c  a      g  c       cg cg       a  g       ta gt        cg        at cg        ta        gt gt        gt        gc tg        gc        cg gc        cg        cg                         cttttttcatggctgttgatggagtacgttggtcgttttcgagacaagtactagaaaagatattgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0007 Uroporphyrinogen-III methylase ... can be seen here [H] COG1587 Uroporphyrinogen-III synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:206 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.80 kcal/mol Antiterminator: Size=20 nt.     Delta G= -6.10 kcal/mol Anti-antiterminator:   Size=17 nt.     Delta G= -4.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case catgactcaattatcgtgtatataccacacggtaaacacctgttgagagggtggtcggtttttacgccaccaatgtttgaactggccgttttctttgaaa atcgcgctcggtttggatgccctcgtaaaataaggtgcaaatattgtgcgccgaccagttatgtcctcatccgacggcggtcagtgtgcttcattaaatt gtcgtggacaatcccggatcgaaaatttgattcggcttttttcatggctgttgatggagtacgttggtcgttttcgagacaagtactagaaaagatattg ATG     NCgl0414 --- NCgl0415 Gene: NCgl0414     GI: 19551674     BI number: NCgl0414     GOG: COG0007,COG1587     Description: uroporphyrinogen-III synthase/methylase Gene: NCgl0415     GI: 19551675     BI number: NCgl0415     GOG: -------     Description: hypothetical protei                       c                     a  c                     c  a                     c  a                      gt                      cg                      at                     t  t             t       t  t           t  t       tg   g       t  t       ta t  a      g  a       ta t  g       gc        gc g  a       cg        gt tg       t  |       cg cg        gc        tg cg        gc        gc at        ta        gc cg        gc        tg                         ttttctttgaaaatcgcgctcggtttggatgccctcgtaaaataaggtgcaaatattgtgcgccgaccagttatgtcctcatccgacggcggtcagtgtgcttcattaaattgtcgtggacaatcccggatcgaaaatttgattcggcttttttcatggctgttgatggagtacgttggtcgttttcgagacaagtactagaaaagatattgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0007 Uroporphyrinogen-III methylase ... can be seen here [H] COG1587 Uroporphyrinogen-III synthase ... can be seen here     ..................................................................................................................