                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:168 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCGTAGCTCAATTGGCAGAGCAACGGTCTCCAAAACCGTAGGTTGCAGGTTCGATT
CCTGTCGCCCCTGCAAgatgaacacccttgatctggttaaacaataaaaccagatcaagggtgttttttgtttcatcaagggatcttt
cacctgtagcaggtatgtcctaataaatattgcgagggttcgcgggattaatgtactctcgaaggttgaacacagggctgcgattgtgctggatcaaatg
tctgcacgaaaaattgttatcgcccctggatgagtagtgatttagaggagtgctGTG

    NCgl0457 Gene: NCgl0457     GI: 19551717     BI number: NCgl0457     GOG: COG0690     Description: preprotein translocase subunit Sec             a         a CC       a  c      c  a T  T      g  a      a  t TG       t  c      a  a AT       a  c      a  a GC        gc        ta CG        At        ta T  C       At        gc T  C       Cg        gc GC       G  a       ta GC       T  t       cg AT       C  c       ta CG       C  t       at GC        Cg        gc TA        Cg        ta TA        Gt        ta                         gggtgttttttgtttcatcaagggatctttcacctgtagcaggtatgtcctaataaatattgcgagggttcgcgggattaatgtactctcgaaggttgaacacagggctgcgattgtgctggatcaaatgtctgcacgaaaaattgttatcgcccctggatgagtagtgatttagaggagtgctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0690 Preprotein translocase subunit SecE ... can be seen here     ..................................................................................................................