                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:162 nt.    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-17.60 kcal/mol
Antiterminator:    Distance from promoter:117 nt. Size=58 nt.     Delta G=-19.40 kcal/mol
Anti-antiterminator:    Distance from promoter:102 nt.    Size=43 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggta-taaagt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggtatttcggccgatcctgccctaaagtaatagaccgaagtttgaacgatcggccacgcgccagatcgagctcaaggttcaccgaagaccgtaggtca
tccgcatgacggatcgaaggtttcctacccttaggaacggcccacgcaggagacacttgaacgccttagattccttatgtggaatgtatagcgccctgtg
ctcttgcacggggcttttctcattggtttattgaccgtgtgaaagctccgcggatcagtagattacacataagaggaaggaggcgaagtaATG

    NCgl0468 Gene: NCgl0468     GI: 19551728     BI number: NCgl0468     GOG: COG0244     Description: ribosomal protein L1            at           t  g           t  t            cg            cg   a        ta g  c       ta a  a       at gc       g  g gt        at at        ta cg       t  t g  a      c  a c  a       cg a  c       gc c  |       cg c  |      a  c cg       a  c gc       g  c gc       t  t       ct |  t      t  |      t  t |  t       cg        cg |  a       at        gc |  g       cg        ta c  a      a  |       gc at        gc        tg at        at        cg gc        gc        cg gc        gt        cg at        at        gc                         ttttctcattggtttattgaccgtgtgaaagctccgcggatcagtagattacacataagaggaaggaggcgaagtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0244 Ribosomal protein L10 ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:162 nt.    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-17.60 kcal/mol Antiterminator:    Distance from promoter:125 nt. Size=58 nt.     Delta G=-19.40 kcal/mol Anti-antiterminator:    Distance from promoter:98 nt.    Size=54 nt.     Delta G= -9.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttggta-taaagt. It has a score value of 61.58 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttggtatttcggccgatcctgccctaaagtaatagaccgaagtttgaacgatcggccacgcgccagatcgagctcaaggttcaccgaagaccgtaggtca tccgcatgacggatcgaaggtttcctacccttaggaacggcccacgcaggagacacttgaacgccttagattccttatgtggaatgtatagcgccctgtg ctcttgcacggggcttttctcattggtttattgaccgtgtgaaagctccgcggatcagtagattacacataagaggaaggaggcgaagtaATG     NCgl0468 Gene: NCgl0468     GI: 19551728     BI number: NCgl0468     GOG: COG0244     Description: ribosomal protein L1   a g  c a  a       tg gc       a  t gt       a  a at        gt cg        ga g  a       tg c  a       gc a  c       tg c  |      a  c c  |       tc cg        tc gc       c  t gc       c  g |  t       tt |  t       tg |  a       ac |  g      g  t c  a      a  c at       t  t at       t  t       ct gc       c  |      t  t gc        c        cg at        g        gc |  t       c        ta |  a      a  |       gc |  t       a        tg t  g       g        cg t  t       t        cg cg        t        cg cg        c        gc                         ttttctcattggtttattgaccgtgtgaaagctccgcggatcagtagattacacataagaggaaggaggcgaagtaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0244 Ribosomal protein L10 ... can be seen here     ..................................................................................................................