                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -6.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagaaattggatttgagaaattgtatttgaggtatcgaacttaagtgggggagtccttcgcctcgatatggctgcagcagtcctattgctcgacttcgcg
tgtgctgacttctcatgctcaacttctcgtcatacgacttcagtaggaaatcctgacggcgccgacggaagtcgaccacgtgaagtcgagtgtgtgaagt
cgccctttaaggcccgtaaagcactccacaacacttcacggcaggccgtaatttccctgtgaggtactttcttgcaagttgtagcgcaccgccgatacca
ATG

    NCgl0470 Gene: NCgl0470     GI: 19551730     BI number: NCgl0470     GOG: NOG45988     Description: hypothetical membrane protei            ca           c  c           t  a        a tt       c  a      t  a t  a      a  c      g  t c  a      c  a      c  t cg        gc       c  t cg        at        gc gc        at        gc |  c      a  c      a  | c  c       ta       c  | t  g       gc        gc g  t       cg        gt a  a      |  g       cg a  a      |  c       at g  a      |  a       cg tg        cg        ta gc        cg        tg ta        gc        cg gc        gc        at                         actttcttgcaagttgtagcgcaccgccgataccaATG     ..................................................................................................................