                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-24.10 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G=-11.91 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATGGCGAACGCCGAGCACCGAATTTCCGAGTGGTGGAATATGACACCGCGAGGGAC
TGCGTCACCACGTATTTCCCTGAGGCCAACGTATTGGTTCCATTGGATTCAGTAGCTG
AAAAATCCAACACTCCAGTGTCCAAGTCAGTTGTGGTTCGCCTTGAAGCAACAGGACG
TACTGCTTCTTAGaaaaacaccagggaattttccgcgcccgcttccttgtttaaataaacgaggatgcgggcttatttataattgcagttt
tacaattgcagccatcatcagaaacgagtttcactGTG

    NCgl0506 --- NCgl0505 --- NCgl0504 --- NCgl0503 Gene: NCgl0506     GI: 19551765     BI number: NCgl0506     GOG: NOG26190     Description: hypothetical protein Gene: NCgl0505     GI: 19551764     BI number: NCgl0505     GOG: COG1526     Description: formate dehydrogenase accessory protein Gene: NCgl0504     GI: 19551763     BI number: NCgl0504     GOG: -------     Description: hypothetical protein Gene: NCgl0503     GI: 19551762     BI number: NCgl0503     GOG: COG0656     Description: aldo/keto reductas   G G  A A  C CG AT |  A |  C AT CG GC AT AT GC |  T |  T |  A |  G |  a |  a |  a |  a |  a |  c |  a                 aa |  c       cc       a  t |  c      g  c       ta Ta        cg        ta Tg        gc        ta Cg       c  |       gc Cg       c  |       tg |  a      t  |       ta |  a      t  |       cg G  t      t  |       cg C  t      t  |       ta T  t       at       t  t T  t       at        cg Gc        gc        gc Gc        gc        cg Tg        gt        cg Gc        at        cg Tg        cg        gc                         ttatttataattgcagttttacaattgcagccatcatcagaaacgagtttcactGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1526 Uncharacterized protein required for formate dehydrogenase activity ... can be seen here [R] COG0656 Aldo/keto reductases, related to diketogulonate reductase ... can be seen here     ..................................................................................................................