                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:64 nt.    Distance to gene:135 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:53 nt. Size=17 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGAGA-TAAGTT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAGATGGCAGAAATGCTCCGCTAAGTTCTCTTCGATTGCGCGTTGTAATTTACCGA
GGTCCTTCATaaaacttcattttaggtatcacaaaggtgccataagtcgcaccctttgttagactgcaaaactcgccttttggttccctcaaa
agcaaatctgagaatcttcccactttcactagtcttatcccggaccagcgcactacagttcctggattaggggatgtaaagatctaaagctgggggaata
cATG

    NCgl0546 --- NCgl0547 Gene: NCgl0546     GI: 19551805     BI number: NCgl0546     GOG: NOG47077     Description: hypothetical protein Gene: NCgl0547     GI: 19551806     BI number: NCgl0547     GOG: COG0277     Description: FAD/FMN-containing dehydrogenas   a        aa c  a      t  g a  a      a  t cg       c  c tg        cg at        gc tg        ta gc        gc gc        gc             ctttgttagactgcaaaactcgccttttggttccctcaaaagcaaatctgagaatcttcccactttcactagtcttatcccggaccagcgcactacagttcctggattaggggatgtaaagatctaaagctgggggaatacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0277 FAD/FMN-containing dehydrogenases ... can be seen here     ..................................................................................................................