Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:178 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-16.00 kcal/mol

                                                                        Nomenclature/Definitions

aaggcaaaaaatagcgaaaacacaccccaggtttttcccgtaaccccgctaggctatgcaatttcggtttaacccagtttttcaaagaaggtcactagct
tttccgctggtcaccttctttttggtttttcaacgcagagatagtacactttactctttgtgtgtggagtcaaacctcccctttaaggggtgcgcttgga
cagcaggacaaattcgggtcaccaccggccgccgaatttagcttccttccgaacatattcctggctggcagttctagaccgactaattcaaggagtcatt
GTG

    NCgl0556 --- NCgl0557


Gene: NCgl0556     GI: 19551815     BI number: NCgl0556     GOG: COG0102     Description: ribosomal protein L13
Gene: NCgl0557     GI: 19551816     BI number: NCgl0557     GOG: COG0103     Description: ribosomal protein S


          tt
         t  c
         t  c
          cg
          gc
          at
          tg
          cg
          at
         c  c
          ta
          gc
          gc
          at
          at
          gc
            tttttggtttttcaacgcagagatagtacactttactctttgtgtgtggagtcaaacctcccctttaaggggtgcgcttggacagcaggacaaattcgggtcaccaccggccgccgaatttagcttccttccgaacatattcctggctggcagttctagaccgactaattcaaggagtcattGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0102 Ribosomal protein L13 ... can be seen here
[J] COG0103 Ribosomal protein S9 ... can be seen here

    ..................................................................................................................