                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-25.40 kcal/mol
Anti-antiterminator:   Size=68 nt.     Delta G=-15.52 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCCAGCAGAGCGCGGCGAGCTGAAGAAGGCTGGCTTCCTCACTCGTGACGCTCGTGC
AGTTGAGCGTAAGAAGGCTGGTCTGCACAAGGCACGTCGTGCACCTCAGTACTCCAAG
CGTTGAtatttactcaacgtttgcgcaaacccgtttcgccgaatttctcggtggggcgggttttccgcattcttggggtttcttgtgacttaggga
cttgggtttacacagctcaaccgaagaaaaattgttcaatagagttttgaacaatgcgatcttggccaggccgtgcataattaatcgcATG

    NCgl0558 Gene: NCgl0558     GI: 19551817     BI number: NCgl0558     GOG: COG1109     Description: phosphomannomutas   t t  t a  a t  c At Gc Ta Ta Gc Cg Gt At At Cg C  c T  | C  | A  | T  | G  | A  | C  | T  | C  |        t C  |      t  t        t A  |      a  c      t  t Cg        at       g  t Gc        gc        gc Ta        cg        gc |  a       cg        cg G  a       gt        gc C  c       cg       |  a T  c      t  g       gt Gc       t  g       gt Cg        tg        gc At        gc       t  | |  t       cg        gt |  t       cg        gt |  c       cg        cg Cg        at        tg Gc        at        cg Gc        at        tg                         tttcttgtgacttagggacttgggtttacacagctcaaccgaagaaaaattgttcaatagagttttgaacaatgcgatcttggccaggccgtgcataattaatcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1109 Phosphomannomutase ... can be seen here     ..................................................................................................................