                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-19.90 kcal/mol

                                                                        Nomenclature/Definitions

CCGCAATGGTCGGCTACATCGGTGGCGGTGGTCTTGGTGACTTCGCCATTGTTTACGG
CTACCGCGCCTTCGACAACGAAGTTATGTACGTTGCCGTCCTGGTTATCGTCATCATC
GTGCAGGCAGCCCAGCTTCTGGGCAATTGGCTGTCCAAGAAGATCATGCGCCGCTAAa
cctcttgcatagaaaaacccgtgatatctacctcgaagtaggcatcgcgggtttttctatgcccaaatgcccatatagtgttgatgcgttagtccaccca
cgcagctacgccccaaaggaataatcTTG

    NCgl0607 --- NCgl0606 Gene: NCgl0607     GI: 19551866     BI number: NCgl0607     GOG: COG1136     Description: ABC-type transporter, ATPase component Gene: NCgl0606     GI: 19551865     BI number: NCgl0606     GOG: COG0577     Description: hypothetical ABC-type transporter, permease componen           cg          t  a          c  a           cg           at           ta           cg          t  g          a  c           ta           at           gc           tg           gc           cg           cg           cg           at             ttttctatgcccaaatgcccatatagtgttgatgcgttagtccacccacgcagctacgccccaaaggaataatcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here     ..................................................................................................................