                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCTCGCTGCTCAGACCGAGGACGCAGATCTGGCTGCTACCTTCGCACCAGTCGCAGA
AGCACTGAACACAGGCGCTGCAGACATCGATGCTGCACTGCTCGCAGTTCAGGGTGGA
GCAACTGACCTTGGTGGCTACTACTCCCCTAACGAGGAGAAGCTCACCAACATCATGC
GCCCAGTCGCACAGTTCAACGAGATCGTTGACGCACTGAAGAAGTAAagtctcttcacaaaaagc
gctgtgcttcctcacatggaagcacagcgctttttcatatttttattgccataatgggcacATG

    NCgl0633 Gene: NCgl0633     GI: 19551893     BI number: NCgl0633     GOG: NOG26287     Description: hypothetical membrane protei ca a  a c  a ta ta cg t  c c  | tg gc        ac at       c  a A  g      t  t At        cg Tg        cg Gc        ta At        ta At        cg Gc        gc A  c       ta At        gc Gc        ta Ta        cg             cgctttttcatatttttattgccataatgggcacATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-26.40 kcal/mol Antiterminator: Size=43 nt.     Delta G= -9.50 kcal/mol Anti-antiterminator:   Size=27 nt.     Delta G= -8.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGCTCGCTGCTCAGACCGAGGACGCAGATCTGGCTGCTACCTTCGCACCAGTCGCAGA AGCACTGAACACAGGCGCTGCAGACATCGATGCTGCACTGCTCGCAGTTCAGGGTGGA GCAACTGACCTTGGTGGCTACTACTCCCCTAACGAGGAGAAGCTCACCAACATCATGC GCCCAGTCGCACAGTTCAACGAGATCGTTGACGCACTGAAGAAGTAAagtctcttcacaaaaagc gctgtgcttcctcacatggaagcacagcgctttttcatatttttattgccataatgggcacATG     NCgl0633 Gene: NCgl0633     GI: 19551893     BI number: NCgl0633     GOG: NOG26287     Description: hypothetical membrane protei            tc           c  t           t  t            gc            aa            Ac           A  a       ac GA       T  |      c  a A  T       Ga       t  t GC        Aa        cg CG        Aa        cg AT       G  a       ta AT        Ag        ta CG        Ac        cg TA        Gg        gc |  C       Tc        ta |  G       Ct        gc |  C       Ag        ta TA       C  t       cg GC        Gg        gc AT        Cc        cg CG        At        gc                         tttttcatatttttattgccataatgggcacATG     ..................................................................................................................