                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-15.00 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATTTCCGTTTGCCTAGGAATCGGGCGGCGTTTGATATGTCCGCCGATATGCCCACCG
CGTCCTTGTGGTGCCTGCGAGTCGACAACCTTGACAGGATTTTTTCCAGATTCGTGCA
Tgtaagcacaatatcggacagctccctcaccggcactattgcagacaacaaatgtgcgtacttagccacctttcaaaaggttgtgacgtgagacatttcc
tccaatacctctccagtgatattctgtcgggcagcctaacctaagttattccgttgttgttcgagaaagagagagaaacttttcATG

    NCgl0639 --- NCgl0638 --- NCgl0637 --- NCgl0636 --- NCgl0635 Gene: NCgl0639     GI: 19551899     BI number: NCgl0639     GOG: COG0614     Description: ABC-type transporter, periplasmic component Gene: NCgl0638     GI: 19551898     BI number: NCgl0638     GOG: COG0609     Description: ABC-type transporter, permease component Gene: NCgl0637     GI: 19551897     BI number: NCgl0637     GOG: COG0609     Description: ABC-type transporter, permease component Gene: NCgl0636     GI: 19551896     BI number: NCgl0636     GOG: COG1120     Description: ABC-type transporter, ATPase component Gene: NCgl0635     GI: 19551895     BI number: NCgl0635     GOG: COG2375     Description: hypothetical protei GT T  C A  C T  G A  C GC        CC TG       T  T TA        GT |  T       CG TA        GT GT        CG CG        CG GC        AT        AC GC        CG       G  A C  C      |  C      C  A G  A      |  C      T  C GC       C  T       GC GC        CG        AT CG        GC        GT T  C       TG        CG A  G      A  A      |  A AT        TG        GC GC        AT        TA GC        GC        CG AT        CG        CG                         ATTTTTTCCAGATTCGTGCATgtaagcacaatatcggacagctccctcaccggcactattgcagacaacaaatgtgcgtacttagccacctttcaaaaggttgtgacgtgagacatttcctccaatacctctccagtgatattctgtcgggcagcctaacctaagttattccgttgttgttcgagaaagagagagaaacttttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here [P] COG2375 Siderophore-interacting protein ... can be seen here     ..................................................................................................................