                                                                        Gene putatively regulated by attenuation in C_glutamicum

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcatggtatctaggatccaaaactgccatagttggcagcgcaaatctttgttagatcggagtttgtggtgtcggcctgaattgctcttctgtaccaactc
gccccacacgcgctcacaaactgataccctcggctactagtgacacggggtgcaaaagcactttaaaaaagctttcgctgagattacacccgtcgaacct
gatccagttagtactggcgaagggactgtcgcattggacccatcctcccaagggataggtccctctgcccttcgccccaacccaagaagggcgttttttc
ATG

    NCgl0689 Gene: NCgl0689     GI: 19551949     BI number: NCgl0689     GOG: COG1028     Description: dehydrogenase/oxidoreductas   c c  a c  a tg cg cg ta        aa at       c  c c  a      c  c cg       c  c cg       c  a at       g  a gc        cg gc        ta |  c       ta t  t       cg t  c       cg at        cg cg        gc gc        tg             ttttttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................