                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCATGTCATCTTGATCGGAATGGGCCGTGACCTCATTCCTTTGCAATACACCATGCA
AGGTTTAGGCGAGGCCGAGCGTAACGACGCCCAACAGCGCGAACGCTCCTTGCTCTAC
GTTGCAGCTTCTCGTGCACGTGATGCCCTTGTTCTCACCACGCATACTGAGCCTTCGG
AGTTGCTGCCGCGGGTTTAGagcaccaagtaactaaagttcgaaagtatttccgaacggtgtcggcctctgcgcatacactgtat
ttttaaagaaaattcttctcaattctaagggtgaatatccaATG

    NCgl0703 Gene: NCgl0703     GI: 19551963     BI number: NCgl0703     GOG: COG1479     Description: hypothetical protei ta g  t a  t a  t a  c gc cg ta ta gc a  | a  | a  |       ct t  |      t  g c  |      c  c a  |       cg a  |       gc t  |      g  a g  |      c  t a  |       ta a  |       gc cg        ta cg        gc at        gt cg        cg gt        at             atttttaaagaaaattcttctcaattctaagggtgaatatccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1479 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................