                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-31.50 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-16.72 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACTCTTCCCTCGACGACAACACCGTCATCGTCGTATCCGCCGGCGATTACGCTGGC
CCTACCGCGGAAGCAAACGCCGTGACATCCAGCACCGTCGGCCAGCCCGGTGCGGACG
TCGGTGAACCGATTGAAAGCCCCGAGTTCGATGCTGGTGGCGACGGTCCCCGTTGCGT
TAACTAAaaccccgcttttcgacgcctccccgcagcccaccaccgtgggctgcggggtgtggcgtttttgccacaaagtggaccgtattcgcaaa
tactttgttaagacgcgttaatctttaacctATG

    NCgl0707 --- NCgl0706 --- NCgl0705 --- NCgl0704 Gene: NCgl0707     GI: 19551967     BI number: NCgl0707     GOG: COG0553     Description: SNF2 family helicase Gene: NCgl0706     GI: 19551966     BI number: NCgl0706     GOG: COG1002     Description: type II restriction enzyme, methylase subunits Gene: NCgl0705     GI: 19551965     BI number: NCgl0705     GOG: COG1205     Description: putative helicase Gene: NCgl0704     GI: 19551964     BI number: NCgl0704     GOG: COG0210     Description: putative helicas             A           T  A           C  a           A  a           A  c           T  c           T  c   G        Gc C  A       Cg T  T       Gc TG       |  t GC       |  t AT       |  t G  |      |  t CG       |  c CG        Tg |  T       Ta CG        Gc        ac CG        Cg       c  c GC       |  c       cg A  G      C  c       at A  A      C  t       cg A  |      C  c       cg G  |      T  c       cg T  |       Gc        gc T  |       Gc        at A  |       Cg        cg GC       A  c       gc CG       G  a       cg CG        Cg        cg A  |       Gc        cg AT       |  c       cg GC        Gc       |  t T  C       Ta       |  g GC        Gc       t  t GC        Gc        cg CG        Ta        cg                         cgtttttgccacaaagtggaccgtattcgcaaatactttgttaagacgcgttaatctttaacctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KL] COG0553 Superfamily II DNA/RNA helicases, SNF2 family ... can be seen here [V] COG1002 Type II restriction enzyme, methylase subunits ... can be seen here [R] COG1205 Distinct helicase family with a unique C-terminal domain including a metal-binding cysteine cluster ... can be seen here [L] COG0210 Superfamily I DNA and RNA helicases ... can be seen here     ..................................................................................................................