                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-25.30 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGAACACCCAGCAACCCCAATGAGTGTGGATGACGCACTATCCGAGATGGAATTGGT
TGGACACGATTTCTACCTCTTCGTCAACGAAGAGACCAACCAGCCATCGGTGGTGTAC
CGCCGACACGCATTCGACTATGGATTAATTTCCCTGTCCGATGCATAGcaattagttgctaagt
acccgctaccgtaacggtagcgggtactgtgttttaggaaccgtgcgtagttttaggaacagtgcgtacaatataggttcgttatcatttccgtatcgct
atttataaggacgactgctcGTG

    NCgl0726 Gene: NCgl0726     GI: 19551985     BI number: NCgl0726     GOG: COG0653     Description: preprotein translocase subunit Sec AA T  T T  T       ta         a AT       t  g      t  a GC        at        gc GC        at        cg T  C       cg        cg A  T       Gc        at T  |       At        ta CG        Ta        cg AT       A  a       gc GC        Cg        cg C  C       Gt        cg TG        Ta        cg TA       |  c       at AT       A  c       ta CG        Gc        gc GC        Cg        at                         gtgttttaggaaccgtgcgtagttttaggaacagtgcgtacaatataggttcgttatcatttccgtatcgctatttataaggacgactgctcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0653 Preprotein translocase subunit SecA (ATPase, RNA helicase) ... can be seen here     ..................................................................................................................