                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-26.20 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.94 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAATGTGAAAACTTTCAGCGGCTCCGACAGCACGTTCGTCAACGCACTGTACAAAT
ACAAGTGGGTCATCGCGATCGTCTGGCTGCTGCTCATCGCAGCCGCAGCTGTGTGGTC
ATTCCGCTACATGTTCTAGgcatttaaggctttcaggccggcgcaacctttgcggttgtgccggtcttttttgcttgccgacgccc
acccccacgtctaagttttcccctatttacacacacctgaccgaagctgtaaggtttgcctaatctttttcaatctaaagtcaggatattcacagcccAT
G

    NCgl0774 --- NCgl0773 Gene: NCgl0774     GI: 19552035     BI number: NCgl0774     GOG: COG0614     Description: ABC-type cobalamin/Fe3+-siderophore transport system, periplasmic component Gene: NCgl0773     GI: 19552034     BI number: NCgl0773     GOG: COG2375     Description: siderophore-interacting protei   A C  T T  T GC GC                   t TG        tc       t  g GC       t  a      t  c |  T       tg        cg TA        cg        cg GC        gc        at TA        gc        at |  T      a  g       cg CG       a  g       gt GT       t  c       cg AT       t  g       gc |  C      t  c       gc C  T      a  a       cg G  A      c  a       cg CG        gc        gt Cg        Gc        gc Gc        At        at                         tttttgcttgccgacgcccacccccacgtctaagttttcccctatttacacacacctgaccgaagctgtaaggtttgcctaatctttttcaatctaaagtcaggatattcacagcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG2375 Siderophore-interacting protein ... can be seen here     ..................................................................................................................