                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGAGATCCTCAACGGCATGGCAGATATGTTCGAGAAGGCAGCTCAGTAGgggatcgatccca
cactgacccctaagtaatgcgcaaagttttatgcgtaaaaatttcttaggttaggctctaatatgaaaggctgtcttgtaaagaacaaggcagccttttt
acttgtcttaaataaatattttgaattgagaaccaagacctcgttttggccgcaagttctcgttagttaaaaactgtaggaaaccaggttccacacatga
cacacaatcggtttaacagggaaggggatcggcactgATG

    NCgl0777 --- NCgl0778 --- NCgl0779 Gene: NCgl0777     GI: 19552038     BI number: NCgl0777     GOG: COG4606     Description: ABC-type cobalamin/Fe3+-siderophore transport system, permease component Gene: NCgl0778     GI: 19552039     BI number: NCgl0778     GOG: COG4605     Description: ABC-type cobalamin/Fe3+-siderophore transport system, permease component Gene: NCgl0779     GI: 19552040     BI number: NCgl0779     GOG: COG4604     Description: ABC-type cobalamin/Fe3+-siderophore transport system, ATPase componen tt g  t a  t a  a at cg gc cg gt ta        at |  a      t  g |  a      a  a |  a      a  a |  a       ta a  t       cg a  t      t  | t  t       cg gc        gc         a at        gt       a  g at       a  g      a  a ta       t  t       ta cg       t  |       gc cg        gc        ta |  t       gt        ta |  t       at        cg |  a       tg        tg cg       t  t       gc cg       c  a       ta |  c       ta        cg at        ta        gc gc        tg        gc                         tttttacttgtcttaaataaatattttgaattgagaaccaagacctcgttttggccgcaagttctcgttagttaaaaactgtaggaaaccaggttccacacatgacacacaatcggtttaacagggaaggggatcggcactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG4606 ABC-type enterochelin transport system, permease component ... can be seen here [P] COG4605 ABC-type enterochelin transport system, permease component ... can be seen here [P] COG4604 ABC-type enterochelin transport system, ATPase component ... can be seen here     ..................................................................................................................