                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:195 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGATGGTACTGCACTCGGGAGGGTGTGGGAGAGTAGGTTACCGCCGACCaaaaacttaaa
atagtatggataagcccagaaacactgtgtgtttctgggtttattcgtgtttgagggggtgtggtggatacacatggttgtgtgttcaccgcaccctctc
tttttttgtgtttgtgggggtcttgggccccttgtgcacgcggcacgcacgctgggggcaagcgtcgacaagcacaaactttttgcttaattgaatcctt
tgcgcaccaatcaatgggggatcaaatatagtagctgcATG

    NCgl0780 Gene: NCgl0780     GI: 19552041     BI number: NCgl0780     GOG: COG0436     Description: PLP-dependent aminotransferas aa t  g a  c gc         g gc       t  t ta        cg |  g       at |  a       cg |  a       at |  a       at a  c       at ta        gc gc        at at        cg tg        cg at        cg             tttattcgtgtttgagggggtgtggtggatacacatggttgtgtgttcaccgcaccctctctttttttgtgtttgtgggggtcttgggccccttgtgcacgcggcacgcacgctgggggcaagcgtcgacaagcacaaactttttgcttaattgaatcctttgcgcaccaatcaatgggggatcaaatatagtagctgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0436 Aspartate/tyrosine/aromatic aminotransferase ... can be seen here     ..................................................................................................................