                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggtgcagaactaaatagcagcacatcggcacaattgatctgagttctattggcgtgaccgtggctactgattacggtggctgtgggtggtcgggaatgat
gtaaccaacgtgattgtgggggaattggctctcacttcggatatggctaaaccgcatttatcggtatagcgtgttaaccggaccagattgggaaagaaat
gtgtcgagtaacaaaaactgacatgcgcttggcgcatcccagttggtaagaataaacgggactacttccgtaatccggaagagtttttttccgaacaaat
ATG

    NCgl0795 Gene: NCgl0795     GI: 19552056     BI number: NCgl0795     GOG: COG0372     Description: citrate synthas             a           a  t           t  c            gc            cg            cg ta        ta c  c       ta at        cg gt       a  | gc        ta gc        cg cg        at at        gt             tttttccgaacaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0372 Citrate synthase ... can be seen here     ..................................................................................................................