                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-23.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -4.99 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-15.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACCCAGCGCCTGCGCACCGGTGCAAACCGCCTAGAAGCTGGCATGGTTGGCCGAGC
ACCATTGTTCGAGCAGGTCGACGGACGTCGCCTGCCAGAGCATGGCGCTCACCAAGCA
GAGATCAACTTGCTTATCGACGCTGACGCTCGCCTCGGTGCTGACGGCATCTACCAGG
GCTAAacgttagatagctaagaaagctgcattccctaacgggaatgcagctttttgtgttcctagtgcaaatcgaaatctcatgtgatttacttaaa
acctaattaaatctactatcggagatctcATG

    NCgl0803 Gene: NCgl0803     GI: 19552064     BI number: NCgl0803     GOG: NOG45020     Description: hypothetical protei   A G  C T  G CG         g GC       a  a |  A      a  a |  T       ta |  C       cg |  T       gc TA        at GC        tg GC       a  c C  A      g  a T  G      a  t       aa CG       t  t      t  c CG       t  |       cg GC       g  |       cg |  T      c  |       cg C  A      a  |       ta T  A      A  |       ta C  a      A  |       at Gc       T  |       cg Cg       C  |       gc At        Gc        ta Gt        Gc        cg Ta        Gc        gc Cg        At        at                         ttttgtgttcctagtgcaaatcgaaatctcatgtgatttacttaaaacctaattaaatctactatcggagatctcATG     ..................................................................................................................