                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgaagtttaattgagaccatcttgttatctaccggaagtaacactagccggagattcccgatcgggcaagtgaaaagccaaagtttgattactttttagc
aaattgtgcaaaaagtaatacttttctcacagtgttactctccgacgtgccatcgccaaaactatccgtattagtggcacagttgtttattgatgagcaa
gaaaaatagttcgcagacacgacccggtcagatccgacgtcgccggccaaaaccgcaagcacctgcgcaaacgccacagaaggcagctcagcaatcaaag
TTG

    NCgl0825 --- NCgl0826 --- NCgl0827 Gene: NCgl0825     GI: 19552086     BI number: NCgl0825     GOG: NOG06571     Description: hypothetical membrane protein Gene: NCgl0826     GI: 19552087     BI number: NCgl0826     GOG: COG0299     Description: phosphoribosylglycinamide formyltransferase PurN Gene: NCgl0827     GI: 19552088     BI number: NCgl0827     GOG: COG0138     Description: phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolas   c t  c t  c a  g g  a at gc g  g                  t cg                 a  t cg                 a  g gc        aa        at a  a      c  a       cg ta        cg        gc cg        gt       a  | at        at        ta cg        at        ta a  a      |  g       ta a  a      a  a       ta t  a       at        ta g  a       gt        cg a  g       ta        at a  |       gc        ta gc        at        ta gc        at        at                         acttttctcacagtgttactctccgacgtgccatcgccaaaactatccgtattagtggcacagttgtttattgatgagcaagaaaaatagttcgcagacacgacccggtcagatccgacgtcgccggccaaaaccgcaagcacctgcgcaaacgccacagaaggcagctcagcaatcaaagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0299 Folate-dependent phosphoribosylglycinamide formyltransferase PurN ... can be seen here [F] COG0138 AICAR transformylase/IMP cyclohydrolase PurH (only IMP cyclohydrolase domain in Aful) ... can be seen here     ..................................................................................................................