                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTTGACTCTGCTCGCTTGGCTGTCGACCGTGCAGGTGCAGAGCGCGCTACCGGTTC
CGTTGCTGCTTCCGATGCGTTCTTCCCATTCGCTGACGGCTTTGAGGTTCTCGCTGAG
GCTGGCATCACTGCTGTTGTGCAGCCTGGTGGATCCATTCGCGACAACGAGGTCATTG
AGGCAGCCAACAAGGCTGGCGTGACCATGTACCTGACTGGTGCGCGACACTTCGCTCA
CTAAagtttttaaagatttcgcttgaaggcagaccataaggtctgccttttcgcgtattaatgagtacATG

    NCgl0828 Gene: NCgl0828     GI: 19552089     BI number: NCgl0828     GOG: COG2301     Description: citrate lyase beta subuni   C A  A A  A CG CG GC AT CG G  G        C G  |      C  T A  |      A  G GC        TA        AC TG        GC       C  T T  |      T  |       AT AT        AT        GC CG        CG        CG TA        CG        GC GC        AT       C  T GC       G  |       GC A  A       TG        TA GT        GC        GC CG        CG        GT AT        GC        TA                         AagtttttaaagatttcgcttgaaggcagaccataaggtctgccttttcgcgtattaatgagtacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2301 Citrate lyase beta subunit ... can be seen here     ..................................................................................................................