                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-23.70 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-17.40 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACAATGTCGCCCTTCAGGAGGTCAAGATCGACGGTCAGACCGTTCGCATCCCACGC
CGTCTGGTTAAGGCAGCACAGCTCGGTCTCGTGGACGTAGAGCAGTTCTAAaccttaaattc
atcgcctacaaccttttgtaggtaagaatttaacaagagccagttatcttctcttaaaatgaggaggtaactggcttctttatgcttaagaggtgttagc
ataagtgaaatatgttccaacgcgtggacgtcttaattgggaggaagtctgtcacggactggaagacgaaaagggtatcgATG

    NCgl0839 Gene: NCgl0839     GI: 19552100     BI number: NCgl0839     GOG: COG0745     Description: two-component system, response regulato            ct           c  t            at            at            cg            at            ta            cg            cg            gt           c  a           t  a           a  |            cg            ta            ta            at            at         a            at       a  a            ta       t  a   G        ta       t  t C  T      c  c       cg T  G      c  a       ta CG       a  |       cg TA       A  |       tg GC       A  |       ta |  G       Ta        cg |  T       Cg        tg G  A       Ta        at CG        Tg        ta TA        Gc        ta CG       |  c       gc GC       A  a       at A  A       Cg        cg CG        Gt        cg AT        At        gc                         ttctttatgcttaagaggtgttagcataagtgaaatatgttccaacgcgtggacgtcttaattgggaggaagtctgtcacggactggaagacgaaaagggtatcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here     ..................................................................................................................