                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-11.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-14.24 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGTGGTCGCTGTTGACGTGAGCTTCGGCAGCGTCGTCCTGGAATGCTTCGATGA
GGATGAACTCGTTTGGGTTGTCGGTGTTAATTGACCAATCGAAGAAGATGTTTCCTTC
TTCCGCACGGGTCTTTTCTGTAAACTCCGCTACCTGCTCGCGGAAGGTGTCTACATAT
TCTGGCAATGGCTTGAATTTCACATTAATCAAAATCACGACCACCACtgtaccgatcttgtttag
ccagttcagactaggctgggaaccagtgaccccgcacacatttcatgaagggagttaaaccATG

    NCgl0877 Gene: NCgl0877     GI: 19552140     BI number: NCgl0877     GOG: COG0526     Description: hypothetical protei CT G  T T  C A  G A  A G  T G  G TA CG        TT CG       G  A TA        TA GT        GT         T CG        GT       G  T TA        CG       T  T |  A       TA       A  C |  C      |  C       GC |  T       GC        AT |  C       TA        AT |  G       TA        GC |  T       GT        AT |  T       GC        AT |  T      G  G       GC |  G       TA       |  C G  G       TA       |  G CG        TG       C  C GT       |  A      T  A AT       G  A      A  C CG        CG       A  G GT        TA        CG GC       |  T       CG CG        CG        AT TG        AT        GC                         TTTTCTGTAAACTCCGCTACCTGCTCGCGGAAGGTGTCTACATATTCTGGCAATGGCTTGAATTTCACATTAATCAAAATCACGACCACCACtgtaccgatcttgtttagccagttcagactaggctgggaaccagtgaccccgcacacatttcatgaagggagttaaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OC] COG0526 Thiol-disulfide isomerase and thioredoxins ... can be seen here     ..................................................................................................................