                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGGAAGAAGGAAACATCTTCTTCGATTGGTCAATTAACACCGACAACCCAAACGAG
TTCATCCTCATCGAAGCATTCCAGGACGACGCTGCCGAAGCTCACGTCAACAGCGACC
ACTTCAAGGCGGCCTGTGAGCTGTTCCCAACCATCCTGTCTGAGACCCCAGAGATCAT
CAACACCCTTATCGAGGGCAAGACTGAGTGGGACCGCATGGCAGAGTTCGCAGTCAAC
TAAaatatgacctttgctggttggctaattttgggtcaaagttttgtgaaacgaagtaagcttaagttATG

    NCgl0879 Gene: NCgl0879     GI: 19552142     BI number: NCgl0879     GOG: COG1359     Description: hypothetical protei             A           A  a           T  a           C  t           A  a            At            Cg            Ta            Gc           A  |   T       C  | A  G      G  | CG       C  |       gt GC       T  |      g  t |  A      T  |       tg |  G       Gc        cg C  A       At        gc CG        Gt       |  t AT        At       |  a GT        Cg       |  a GC        Gc       |  t G  G       Gt       |  t T  |      T  |      t  t G  |      A  |      t  t A  |      C  |       tg GC       G  |       cg TA        Cg        cg CG        Cg        at AT        At        gc GC        Gt        ta                         aagttttgtgaaacgaagtaagcttaagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1359 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................