                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:58 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTACCTTGTAATTGGTGTGTGGACGGATGAAGGTGCGACGGAACATAAGAAGAGCGAG
CACTTCTTGCGAGCTCAAGAAACACTTCCACCGTTGCTGCAACAAACTCCAATGATTA
TTCAGAGTGAGTTTTCCAAGAAGAAGGGTTGGGAACGTTTCAGCGATTTCACCGTCTA
CTAAggagcccgcaaaagctttgttgctagcggaaaggctttagcgacaaggctttttgcatgttttaatgcagggaatattaactttttgttaatc
tctgaccattgaccttgtacgcttaaaacATG

    NCgl0880 Gene: NCgl0880     GI: 19552143     BI number: NCgl0880     GOG: COG2326     Description: hypothetical protei ca g  a c  a c  a cg gc at        aa gt       g  a gt       g  g |  g       cg At        gc At        at Tg       |  t C  c      |  t At        ta Ta        cg Cg        gc T  |       tg Gc        ta Cg        gc Cg        ta             aggctttttgcatgttttaatgcagggaatattaactttttgttaatctctgaccattgaccttgtacgcttaaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2326 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-17.40 kcal/mol Antiterminator: Size=40 nt.     Delta G= -8.40 kcal/mol Anti-antiterminator:   Size=42 nt.     Delta G= -9.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTACCTTGTAATTGGTGTGTGGACGGATGAAGGTGCGACGGAACATAAGAAGAGCGAG CACTTCTTGCGAGCTCAAGAAACACTTCCACCGTTGCTGCAACAAACTCCAATGATTA TTCAGAGTGAGTTTTCCAAGAAGAAGGGTTGGGAACGTTTCAGCGATTTCACCGTCTA CTAAggagcccgcaaaagctttgttgctagcggaaaggctttagcgacaaggctttttgcatgttttaatgcagggaatattaactttttgttaatc tctgaccattgaccttgtacgcttaaaacATG     NCgl0880 Gene: NCgl0880     GI: 19552143     BI number: NCgl0880     GOG: COG2326     Description: hypothetical protei TC T  A       gg TG       A  a GC       A  g       aa CG       T  c      g  a A  A       Cc       g  g AT        Ac        cg GT        Tg        gc GT        Cc        at GC        Ta       |  t T  |      |  a      |  t TA        Ga        ta GC        Ca        cg GC        Cg        gc G  G      A  c       tg A  |       Ct        ta AT        Tt        gc GC        Tt        ta AT       T  |       ta A  A       Ag        tg GC        Gt        cg AT        Ct        gc                         tttttgcatgttttaatgcagggaatattaactttttgttaatctctgaccattgaccttgtacgcttaaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2326 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................