                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:143 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-16.10 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-15.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTGCCTCAGCACCCAGCCAGTAATGGCAGCTTGCGGCAGCATCGATCCGGCTTCGCG
GATTGGAACCAGAAGCGCCAGCAAAAAGCCCGGCGCGCCAGCGGCTTGCAGCAACCAG
GGCAGGACTGTTTTGGCGGCAACGATTTGATCGCCGATGTTTTGCAGGCCGTTGGCCC
AAATGAGGCGGCGTGCGTTGCGCTCCTCTGTGGGATTTGTCATgggtgaaagcttagaagaactacac
cgtttggttgatatgatgtggggtgtttatgaaaatttgtttgagggagtgaaggcgcATG

    NCgl0908 Gene: NCgl0908     GI: 19552171     BI number: NCgl0908     GOG: COG2132     Description: putative multicopper oxidas   A A  A A  A CG GC |  C A  C CG CG GC CG        AC GC       A  C A  G      C  A A  |      G  G G  |      A  G A  |       CG C  |       GC C  |       TA A  |       TG A  |       CG        GA G  |      |  A      C  T G  |       GC        AT T  |       GT        AT T  |       CG        CG A  |       GT       |  A GC       |  T       GT GC       |  T       GC |  A       AT        CG CG        CG        GC GC        CG        GC CG        GC        TG TG        CG        TA                         TGTTTTGCAGGCCGTTGGCCCAAATGAGGCGGCGTGCGTTGCGCTCCTCTGTGGGATTTGTCATgggtgaaagcttagaagaactacaccgtttggttgatatgatgtggggtgtttatgaaaatttgtttgagggagtgaaggcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2132 Putative multicopper oxidases ... can be seen here     ..................................................................................................................