                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=12 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATAATCGTGGCTACGCTCGATACGGCTAATTTCCTGATGAATGCCCTTCACagtgcttct
tcctttccttctcgcaagaagtgttccttcgggagtgtccgcgaaggatttttggtaaccccgttagtggatgttccaccgatcgcttgagttcaccttg
agaactctttttgttaacctagagttaactttaggtgaacaacgaaacaaatgcaagcccccaatcatgggtttctaccaattaaattttctttcagaaa
atatctccccacataaaagttccttgataggctcgagagATG

    NCgl0916 Gene: NCgl0916     GI: 19552180     BI number: NCgl0916     GOG: COG0405     Description: gamma-glutamyltranspeptidas             t           g  g           a  t            gc            gc           |  g            gc tc        cg t  g       ta cg        ta cg        cg ta        cg tg        ta             tttttggtaaccccgttagtggatgttccaccgatcgcttgagttcaccttgagaactctttttgttaacctagagttaactttaggtgaacaacgaaacaaatgcaagcccccaatcatgggtttctaccaattaaattttctttcagaaaatatctccccacataaaagttccttgataggctcgagagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0405 Gamma-glutamyltransferase ... can be seen here     ..................................................................................................................