                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAATCGCCGCAAAGGGTGAAGGCTTCTGGACCACTCAGTTCCCACAAATCGGTGAT
TGGAACGAAGATCAGGCAGCAGCACTTGCCGACCGCGCACAAACCTGTGGCCTAGTTA
AGGCTGACACCTACCTTTCTGAGCTGTCCTCCAACTTCTCTTCCTAAaaggttcgggggtaaccc
caaaaatcacttaagtcacaacagtcacataaatcacttcagtaacgtatgattttggactgttgtggcttttgccatatttatttcatttccatctcag
tgatctcttaaggaaacccATG

    NCgl0932 Gene: NCgl0932     GI: 19552196     BI number: NCgl0932     GOG: NOG24982     Description: hypothetical protei ac a  g t  t g  a at cg ta |  t |  t t  t c  t a  g cg ta a  c a  t a  g       tt t  t      t  t at        cg cg        gc at        gc cg        ta tg        gt gc        ta             tttatttcatttccatctcagtgatctcttaaggaaacccATG     ..................................................................................................................