                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cttgggtaatatgaataactcaccacacattgtaaatttgtgatgtagatcatcaaagcttctaccagtggatttaatgaagtttcagtcgtggaaatca
ggtcttggcacggtgtatgtgaatgctctactaattgcataggaggctgatttagcgtgtctttttgggtcttttggttagaaagacacaggatttttta
cttaaagaggcgtgaagtaatcaggtttttctagccaatgcgagagttctaaaacgagccggtaacatcgacccccatgagttcaggggttagaaaagca
ATG

    NCgl0934 Gene: NCgl0934     GI: 19552198     BI number: NCgl0934     GOG: COG2951     Description: hypothetical protei tg g  a ta at tg gc |  t |  c |  t ta gc gt |  a |  a c  t at cg                   t gc                 t  t |  a                c  t gt                 t  g ta        tt       g  g tg       t  a       gt cg       a  g       gt ta        gc        ta |  g       tg        tg g  g      |  t       ta gc        cg        ta at        gt        ta cg        gc        cg ta        at        ta at        gt        gc at        gt        ta at        at        gc                         aggattttttacttaaagaggcgtgaagtaatcaggtttttctagccaatgcgagagttctaaaacgagccggtaacatcgacccccatgagttcaggggttagaaaagcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2951 Membrane-bound lytic murein transglycosylase B ... can be seen here     ..................................................................................................................