                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-22.60 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACTCTTTGTTCGAAGCCGATGAAAAATACTCAGCACCGTTGCCGATCGGTTTTTCAC
TCGCCAGCGTTGAACCACTAGAAGATGGAAGCGTTTGGATGCGTTACGGGGTCAATGG
CCCAGTGGACGCGAACTAGgtagcaaatactcgctctttaggtgagagagctaggcgagttaaggcccgacccctattttccaggg
atcgggccttttctaagtttgagtagcctgggggtattttcggtagcgtataagtcccacgacatatttaaatacggagtctttaggagattaagaagAT
G

    NCgl0942 Gene: NCgl0942     GI: 19552207     BI number: NCgl0942     GOG: COG1983     Description: putative stress-responsive transcriptional regulato ga a  g g  a tg gc                   t gt                 t  c a  |        t       t  t t  |      t  t      t  a t  |      t  c      c  a ta       a  c       cg cg        ta        gt t  |       cg        gt cg        cg        gt gc        cg        cg cg       c  a       ta ta        at       |  g cg        gc       |  t at        cg       a  a t  t       cg       g  g a  a       cg        gc a  a       gc        gc a  g       gc        at cg        at        cg gc        at        cg                         gggtattttcggtagcgtataagtcccacgacatatttaaatacggagtctttaggagattaagaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KT] COG1983 Putative stress-responsive transcriptional regulator ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-20.10 kcal/mol Antiterminator: Size=44 nt.     Delta G=-12.10 kcal/mol Anti-antiterminator:   Size=17 nt.     Delta G= -5.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CACTCTTTGTTCGAAGCCGATGAAAAATACTCAGCACCGTTGCCGATCGGTTTTTCAC TCGCCAGCGTTGAACCACTAGAAGATGGAAGCGTTTGGATGCGTTACGGGGTCAATGG CCCAGTGGACGCGAACTAGgtagcaaatactcgctctttaggtgagagagctaggcgagttaaggcccgacccctattttccaggg atcgggccttttctaagtttgagtagcctgggggtattttcggtagcgtataagtcccacgacatatttaaatacggagtctttaggagattaagaagAT G     NCgl0942 Gene: NCgl0942     GI: 19552207     BI number: NCgl0942     GOG: COG1983     Description: putative stress-responsive transcriptional regulato            ga           a  g           g  a            tg            gc            gt           a  |           t  |           t  |        t            ta       t  t            cg       t  c           t  |      a  c            cg        ta            gc        cg            cg        cg   t        ta        cg t  t       cg       c  a c  a       at        at tg       t  t       gc cg       a  a       cg gt       a  a       cg cg       a  g       cg ta        cg        gc cg        gc        gc                         ttttctaagtttgagtagcctgggggtattttcggtagcgtataagtcccacgacatatttaaatacggagtctttaggagattaagaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KT] COG1983 Putative stress-responsive transcriptional regulator ... can be seen here     ..................................................................................................................