                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-16.36 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATTGAGTCCTTCCTCGTTGGTGGCGCACAGAACCTTGATCCTGCGAAATTGCGCATC
AATGGCGGTGAAGGCCTGGTGTACGGACAGTCTGTGACCGATAAGTGCATCGATATTG
ACACCACCATCGATTTGCTCGCTGAGCTGGCCGCAGCAGTAAGGGAACGCCGAGCAGC
AGCCAAGTAAttaagggcgctagactgttaaatgtgttaaacctgcccagactgctgtacccggtgtatgagcgccgtcttttaagagaacta
gacggcgccaaacagcccggtcacgttgccatcATG

    NCgl0951 --- NCgl0952 Gene: NCgl0951     GI: 19552216     BI number: NCgl0951     GOG: COG0020     Description: undecaprenyl pyrophosphate synthase Gene: NCgl0952     GI: 19552217     BI number: NCgl0952     GOG: NOG27464     Description: hypothetical protei            aa           t  a           t  t           g  g           t  t            cg            at            gt           |  a           |  a           a  a           t  c           c  c            gt CC        cg G  A       gc A  A       gc CG        gc GT       a  a A  A      a  g C  A      t  a Gt       t  | At       A  | |  a      A  | |  a      T  | G  g      G  | Cg       A  | Cg       A  | Gc       C  | Cg       C  | A  |       Gc A  |       At Gc        Cg Gt        Gc G  a       At A  g       Cg        tg A  |       Gt       a  a Ta       |  a       tg Gc       |  c       gc At       A  c       tg Cg        Gc        gc Gt        Cg        gc At        Cg        cg                         tcttttaagagaactagacggcgccaaacagcccggtcacgttgccatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0020 Undecaprenyl pyrophosphate synthase ... can be seen here     ..................................................................................................................