                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-20.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCTTTCGATCCTCGTCCACCAATGGTTACTTCTGGTCTGCGTATTGGTACTCCTGCG
CTGGCTACCCGTGGTTTCGATATTCCTGCATTCACTGAGGTTGCAGACATCATTGGTA
CTGCTTTGGCTAATGGTAAGTCCGCAGACATTGAGTCTCTGCGTGGCCGTGTAGCAAA
GCTTGCTGCAGATTACCCACTGTATGAGGGCTTGGAAGACTGGACCATCGTCTAAgttt
ttctttgagttttcatatgtagaaggcatcgtcggcttcggcctggcggtgcttttctcgttgttttGTG

    NCgl0955 --- NCgl0956 Gene: NCgl0955     GI: 19552220     BI number: NCgl0955     GOG: COG0147,COG0512     Description: anthranilate/para-aminobenzoate synthase component I Gene: NCgl0956     GI: 19552221     BI number: NCgl0956     GOG: COG0115     Description: hypothetical protei AT C  C CG AT GC GT         t |  A      a  g TA       t  t Cg       a  a At        cg Gt        ta At        ta At        tg Gt        tg Gc        gc |  t      |  a |  t       at        tc |  t       gc       t  g Tg        tg        cg Ta       t  t       gc Cg       t  c       gc Gt       c  |      |  t Gt       t  |       cg Gt       t  |       tg At       t  |       gc Gc        tg        cg Ta        tg        tg At        gc        at Ta        At        cg Gt        At        gc                         ttttctcgttgttttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here [EH] COG0512 Anthranilate/para-aminobenzoate synthases component II ... can be seen here [EH] COG0115 Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase ... can be seen here     ..................................................................................................................