Gene putatively regulated by attenuation in C_glutamicum
Characteristics of the secondary structures
Terminator: Distance to gene:46 nt. Distance to run of Ts=0 nt. Size=26 nt. Delta G=-16.20 kcal/mol
Antiterminator: Size=60 nt. Delta G= -7.49 kcal/mol
Anti-antiterminator: Size=48 nt. Delta G=-14.10 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CTGAGCACCTCCGCGGCATCCTTTCCGAGCTTCAGATCGCACACGTTCAAAAGACCGG
CCTGCTGAGCATCTTCACCGACTTCGAATACCCTAACTTCAAGCCTTCCGAGCAGGGC
ATCTCCTCTGTGGACGCTATGCTTGAGCAGCTTGTTGTCTGGACCAAGGCAATGTCCA
CCATTCGCGAGTCTGCGAACGTCTAAaacttaaaaacccctcacaaaagtggcgagctccccgattgggactcgcctcttt
tcgtattctcactaagatcacccgagagaccttgcccaccaccccTTG
NCgl0970 --- NCgl0969
Gene: NCgl0970 GI: 19552234 BI number: NCgl0970 GOG: ------- Description: hypothetical protein
Gene: NCgl0969 GI: 19552233 BI number: NCgl0969 GOG: ------- Description: hypothetical protei
aa
a a
a c
t c
G t c
G C c c
A A a t
A A a c
C T A a
CG A c
AT T a
GC C a
GC T a
TA G a
C C Cg
T | At
GC A g
TA G | a
| T Cg g t
| T Gc c t
| C Tg cg
TG C a cg
GC T g cg
TG Gc ta
TA At c |
CG Gc gc
| T | c at
GC C c gc
AT Gc cg
CG Cg gc
GC Ta gc
tcttttcgtattctcactaagatcacccgagagaccttgcccaccaccccTTG
..................................................................................................................