                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-16.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAATCGCCATTGCATTCTTGTTCAATATGGTTTTGACCAGGACTTCCATGCTGTGGAC
CGATCATTGGCTTGCAAAATTCACTCCACTGACAGTGTGGATTTTAGGGTTCATGGCG
CTGCTGGTGTGGACCGTGGTTGCAGGGGATCAATTAATTCCGAATAATATTCGCACAG
TGCTGCTACTTTTTGCTGGTTTTTCCGGTGGAATTTGGCCTGCGGTCAAGGGGAAGTA
GcataataagcctaaagctttcccatatttattagcctcttagagttctcaggagaaaacgaaatcccATG

    NCgl1057 --- NCgl1058 --- NCgl1059 Gene: NCgl1057     GI: 19552328     BI number: NCgl1057     GOG: COG1146     Description: ferredoxin 3 Gene: NCgl1058     GI: 19552329     BI number: NCgl1058     GOG: COG0436     Description: PLP-dependent aminotransferase Gene: NCgl1059     GI: 19552330     BI number: NCgl1059     GOG: NOG27028     Description: hypothetical membrane protei             G           T  C            CG            CG            GT   T        GC T  T       TA T  T       TA GC       T  | GC       A  |        a TG       A  |      a  t CG       G  |      t  a G  T      G  |      a  a T  G      T  |       cg TG       G  |       Gc TA       G  |      |  c TA       C  |      |  t T  T       CG       |  a C  T       TG       |  a AT        TG       A  a TG        TG        Tg CG        TA        Gc GC        TA        At |  C      G  G       At T  T       GT        Gt CG        TA        Gc GC        CG        Gc TG        Gc        Gc                         atatttattagcctcttagagttctcaggagaaaacgaaatcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1146 Ferredoxin ... can be seen here [E] COG0436 Aspartate/tyrosine/aromatic aminotransferase ... can be seen here     ..................................................................................................................