                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGGATAACGGTGCGGACTGCTACCTGTTCGACGAGGCGATCTTGGTCCAGTTTTACC
AACTGCAGCATCCGTGGGGTGAGTTCGTTTGCTCCGAGGCGTGTGGTGCCCACTTCCA
ATGGGTAGCGTTCAGCCCACTGATCCGGGTTGAAAATTTGGGGTTCTGGGTACCACGT
GTCCAGGATGGTCCCGTCCATGGCGATATTTGCGATTCCAACTGCTTGGGCTCCGCGA
ATGTTTTCACTCATtttttaatcgaccgcttccatcatgttttaactaaggtttgtaggcttaaacctGTG

    NCgl1064 Gene: NCgl1064     GI: 19552335     BI number: NCgl1064     GOG: COG0624     Description: succinyl-diaminopimelate desuccinylas            TC           G  C   A        GC C  C       TG CG        AT        TG AT        GC       C  C T  G       GC        AT G  T      |  A       AT GC        AT        CG GC        CG        CG TA        CG        TG CG       |  C      |  C TG       |  G      T  T TA        TA       A  C GT        GT        GC |  G       TA        CG |  G       GT        GC GT       C  T       TG GC        AT        TA GC        CG        TA                         TGTTTTCACTCATtttttaatcgaccgcttccatcatgttttaactaaggtttgtaggcttaaacctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here     ..................................................................................................................