                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -3.69 kcal/mol
Anti-antiterminator:   Size=75 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGAGCGCGATATCGCCGAAGCGGTGAATAAAATGGTCGCTGATCGAGAGACCGCAG
CCAAATTTGGTCTCGCAGGGCGCGAACGTGCTATCAATGATTTCTCCTGGGCAACGAT
TGCTCAGCAGACCATTGATGTGTACAAATCCTTGATGTAAaaccgaaagccggggaacctctccccggct
tttctcatcggggttaacctgccttcacctgggattatccacccatgtgtgatgaaatcgctaccctgaatcaaagacactggcgtaattgagtgaaggc
aggacaataaagagATG

    NCgl1071 Gene: NCgl1071     GI: 19552342     BI number: NCgl1071     GOG: COG1621     Description: beta-fructosidas   G C  A AT AT CG GC GT GC TA CG C  C TA CG TA T  C T  | A  | GC TA AT AT CG TA AT TG |  T CG GT        ac TA       a  c GC       A  g C  A      A  a        c A  A      T  a      c  t A  A      G  a      a  c G  T      T  g       at C  |      A  c       gc G  |       Gc        gc C  |       Tg        gc GC        Tg        gc GC        Cg        cg GT        Cg        cg AT        Ta        gc                         ttttctcatcggggttaacctgccttcacctgggattatccacccatgtgtgatgaaatcgctaccctgaatcaaagacactggcgtaattgagtgaaggcaggacaataaagagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1621 Beta-fructosidases (levanase/invertase) ... can be seen here     ..................................................................................................................