                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:141 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGGGTACCGTGCGTTCCCGTATTCACCGTGGACGCAGCCAGCTTCGTGCAAGTTTG
GAAGCTGCAGCAATGACCAGCGAGGAAGTTTCTTTGTTGGTTCCAACCCACTAAagttgg
tgtgttttctgacacgacaaacgcaaatgtcgtgtcatttttgcagctcagtgcattattttggggttcgtggtgcggacagggaacttatcacaggcga
catccgttttgagtagtaggtatcttggataagaagttacccacatccttgaaagtcgagacacaggaggtcatcggaagatATG

    NCgl1076 --- NCgl1077 Gene: NCgl1076     GI: 19552347     BI number: NCgl1076     GOG: NOG40123     Description: hypothetical protein Gene: NCgl1077     GI: 19552348     BI number: NCgl1077     GOG: COG1826     Description: hypothetical protei            ag           A  t            At            Tg            Cg            At            Cg           C  t            Cg            At            At GT       |  t       gc A  T      |  t      c  a AT       C  c      a  a GC       C  t      a  a GT        Tg        at AT        Ta        cg GT        Gc        at CG       |  a       gc GT        Gc        cg AT        Tg        at CG        Ta        cg CG        Gc        at AT        Ta        gc GT        Ta        ta                         tttttgcagctcagtgcattattttggggttcgtggtgcggacagggaacttatcacaggcgacatccgttttgagtagtaggtatcttggataagaagttacccacatccttgaaagtcgagacacaggaggtcatcggaagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG1826 Sec-independent protein secretion pathway components ... can be seen here     ..................................................................................................................