                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-11.22 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACGCCTCAAGGATGCCGTACCTGCTCATGTAGAAACAGTCCGCCAACTAGTTTTCG
ACCCCATGGAAGAACGCCACATGGAAGGACTTCGTTCCTACCTCACCGCAGTGTTGAA
CTCCAACACCTGCATTGAGATCAACAACCAACGCGCGGCAGAGCTGTAAgggtttacttggagc
gttttctcaggggtttttaggggttaggagaggggaaatccccgatgtgctctaggttcttattggcgatgattgaagaagaaagaaaaactcaatcagc
cataaaggagcttgatcccgATG

    NCgl1125 Gene: NCgl1125     GI: 19552396     BI number: NCgl1125     GOG: COG1983     Description: hypothetical protei   C C  T A  G C  C A  A A  T C  T CG TA CG A  A AT GC TA         G TA       A  A GC        CG |  A       GC |  A       GT |  C       CG        tt |  C       GT       g  t |  A      C  A      g  a TA       G  A       gc GC       C  g       At |  G      A  |       At A  C      A  |       Tg CG        Cg       G  g GC        Cg        Ta CG        At        Cg CG        At        Gc                         gttttctcaggggtttttaggggttaggagaggggaaatccccgatgtgctctaggttcttattggcgatgattgaagaagaaagaaaaactcaatcagccataaaggagcttgatcccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KT] COG1983 Putative stress-responsive transcriptional regulator ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_glutamicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:114 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -6.90 kcal/mol Antiterminator: Size=29 nt.     Delta G= -6.70 kcal/mol Anti-antiterminator:   Size=34 nt.     Delta G=-11.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGACGCCTCAAGGATGCCGTACCTGCTCATGTAGAAACAGTCCGCCAACTAGTTTTCG ACCCCATGGAAGAACGCCACATGGAAGGACTTCGTTCCTACCTCACCGCAGTGTTGAA CTCCAACACCTGCATTGAGATCAACAACCAACGCGCGGCAGAGCTGTAAgggtttacttggagc gttttctcaggggtttttaggggttaggagaggggaaatccccgatgtgctctaggttcttattggcgatgattgaagaagaaagaaaaactcaatcagc cataaaggagcttgatcccgATG     NCgl1125 Gene: NCgl1125     GI: 19552396     BI number: NCgl1125     GOG: COG1983     Description: hypothetical protei   C A  T A  C        A GC       G  T TA        AC TA        GA GC        TA TA        TC        tt |  C       AA       g  t GC       C  A      g  a AT       G  C       gc CG       T  C       At GC       C  |       At C  A      C  |       Tg C  T       AA       G  g AT        CA        Ta CG        AC        Cg TA        AG        Gc                         gttttctcaggggtttttaggggttaggagaggggaaatccccgatgtgctctaggttcttattggcgatgattgaagaagaaagaaaaactcaatcagccataaaggagcttgatcccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KT] COG1983 Putative stress-responsive transcriptional regulator ... can be seen here     ..................................................................................................................