                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-22.00 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTGATTGCGTTGGCTACCGTGATGGTGTTACTAGCTGGCGTCCTATTTGGCGGAGTT
ACCATGTCGGTTGGCATGCTCGTTCACGAAGCAAGCGTGCTGCTTGTTATCAGCATCG
CCATGCTGTTGCTGCGTCCAACACTTAAAGAAGATGCTGCGCAAGCAAGTGATATTAA
ACGCTCGGAAATACAACAGATCGCATAAccaatggctgggtactgatgtggtgatcagtgcccagtttcttctttctac
tagtgtcggatagaagtacccccagtccagaatgaaggtcaccaccaATG

    NCgl1130 Gene: NCgl1130     GI: 19552401     BI number: NCgl1130     GOG: COG2357     Description: hypothetical protei   c A  c A  a Ta At Cg G  g C  | T  | A  | Gc At Cg        gg A  g      t  t A  |      g  g Cg        ta At        at Ta        gc A  |       ta A  |       cg A  |       at Gc        tg Gt        gc Cg        gc Ta        gc |  t       ta Cg        cg Gt        gt Cg        gt             tcttctttctactagtgtcggatagaagtacccccagtccagaatgaaggtcaccaccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2357 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................