                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATTGAGCGGAGGCAATATCTACCTGAGGTGGGCATTCTTCCCAGCGGATGTTTTCTT
GCGCTGCTGCAGTGGGCATtgataccaaaaaggggctaagcgcagtcgaggcggcaagaactgctactaccctttttattgtcgaa
cggggcattacggctccaaggacgtttgttttctgggtcagttaccccaaaaagcatatacagagaccaatgatttttcattaaaaaggcagggatttgt
tataagtatgggtcgtattctgtgcgacgggtgtacctcggctagaatttctccccATG

    NCgl1132 --- NCgl1133 Gene: NCgl1132     GI: 19552403     BI number: NCgl1132     GOG: COG0018     Description: arginyl-tRNA synthetase Gene: NCgl1133     GI: 19552404     BI number: NCgl1133     GOG: COG0019     Description: diaminopimelate decarboxylas cg g  g g  c a  a g  a cg ta |  a gc at cg gc                  ta c  t                t  c g  a                a  g a  c                 cg a  t                 gc t  a       tg        gt c  |      t  t       gc g  |      a  c       gc gc        tg       c  a gc        ta       a  a gc        ta       a  g at       t  c      g  | at        tg        cg at        cg        ta at        cg        gc at        cg        tg                         tttgttttctgggtcagttaccccaaaaagcatatacagagaccaatgatttttcattaaaaaggcagggatttgttataagtatgggtcgtattctgtgcgacgggtgtacctcggctagaatttctccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0018 Arginyl-tRNA synthetase ... can be seen here [E] COG0019 Diaminopimelate decarboxylase ... can be seen here     ..................................................................................................................