                                                                        Gene putatively regulated by attenuation in C_glutamicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:47 nt.    Distance to gene:70 nt.     Distance to run of Ts=3 nt.   Size=22 nt.     Delta G= -8.40 kcal/mol
Antiterminator:    Distance from promoter:24 nt. Size=32 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaga-taaaaa. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgagagtttttccgttgaaaactaaaaagctgggaaggtgaatcgaatttcggggctttaaagcaaaaatgaacagcttggtctatagtggctaggtac
cctttttgttttggacacatgtagggtggccgaaacaaagtaataggacaacaacgctcgaccgcgattatttttggagaatcATG

    NCgl1136 --- NCgl1137 Gene: NCgl1136     GI: 19552407     BI number: NCgl1136     GOG: COG0460     Description: homoserine dehydrogenase Gene: NCgl1137     GI: 19552408     BI number: NCgl1137     GOG: COG0083     Description: homoserine kinas   t a  t a  t        t gc       a  g cg       a  a tg       a  a a  g      a  c a  |      a  a g  |       cg tg        gc        ta gc        at       a  g gt        at       t  t at       a  |       cg at       t  |       tg g  a      t  |       gc g  a       tg        gt g  |       cg        ta ta        gt        tg cg        gc        cg gc        gt        gt                         accctttttgttttggacacatgtagggtggccgaaacaaagtaataggacaacaacgctcgaccgcgattatttttggagaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0460 Homoserine dehydrogenase ... can be seen here [E] COG0083 Homoserine kinase ... can be seen here     ..................................................................................................................